Lac Promoter

This part is an inverting regulator sensitive to LacI (BBa_C0010, BBa_C0012, etc.) The T7-lac promoter is a hybrid regulatory region consisting of the T7 promoter of T7 phage next to LacO. The hybrid design allows for strong promotion that can nevertheless be: (1)repressed by LacI. (2)induced by lac or IPTG, showing a high expression level. (3)CAP protein will not influence the expression. It is a strong promoter. You can only use this part in E.Coli BL21(DE3).

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

2020 ZJU-China’s Characterization

The Optimal IPTG Concentration and Temperature for the Expression of Protein inE.coliBL21 (DE3) with the Promoter BBa_K1402010 and pSB1C3 and the Relation between the Strength of BBa_K1402010 and IPTG Concentration at the Transcription Level.

Overview

In 2020, ZJU-China constructed an EGFP expression vector (with pSB1C3 as the plasmid skeleton) in which the expression of EGFP was controlled by the promoter BBa_K1402010 and transformed it into E.coli BL21 (DE3) which is commonly used to express protein. Then, by measuring the EGFP fluorescence, we investigate the optimal IPTG concentration and temperature for the expression of protein in E.coli BL21 (DE3) using the BBa_K1402010 in pSB1C3. Meanwhile, we carried out RT-qPCR to directly investigate the relation between the original strength of BBa_K1402010 and IPTG concentration at the transcription level without interfering by context.

Vector construction

Our part vectors contained EGFP were successfully constructed and sequence results were correct. With the induction of IPTG, as shown in Fig1, we can see the green fluorescence obviously under the stimulate of blue light.

Fig1. Fluorescence of EGFP after the promoter BBa_K1402010 with the induction of IPTG.

Fluorescence result

Then we picked the positive clone in Fig 1 for further experiment. When the E.coli BL21(DE3) was cultured at the OD600 between 0.6 to 0.8, we added IPTG in different concentration and cultured the E.coli in different temperature. Absolute fluorescence and OD600 assessed by fluorescence microplate reader was shown below.

Fig2. Fluorescence of EGFP under different treatment condition. Fig 2(A) (B) (C) represents the treatment at 25℃, 30℃ and 37℃ respectively. The horizontal axis shows the different concentrations of IPTG, the vertical axis shows the green fluorescence per OD600 (excitation wavelength: 485 nm; detection wavelength: 528 nm), and segments and data points of different colors show the different culture temperature. Error bar indicates the standard error of replicates.

As shown in Fig 2 above, we can find that even through without induction of IPTG, fluorescence can be measured, suggested that when BBa_K1402010 was used to express protein in E.coli BL21 (DE3) with pSB1C3 as the plasmid skeleton, it is leaky. But the leaky expression is unstable and it is slower than the degradation rate in some condition as shown in Fig 2(A) red line.

Compared the expression level in different temperature, fluorescence in 37℃ was much higher than in 25℃ and 30℃, indicating that the optimum temperature for BBa_K1402010 expressed in BL21 with pSB1C3 as the skeleton is 37℃. And the optimum IPTG concentration in 37℃ was 2mM.

RT-qPCR result

From the results of fluorescence characterization, 37℃ seems to be a more favorable temperature for the opening of BBa_K1402010 in pSB1C3 in E.coli BL21 (DE3), so we chose this temperature as the culture temperature for RT-qPCR. We selected a frequently used housekeeping genes 16S rRNA as reference genes to compare the relative expression level of EGFP controlled by BBa_ K1402010 under different IPTG concentrations of 1 mM, 1.5 mM, 2 mM, 2.5 mM and 3 mM at 37℃.

Fig3. The relative normalized expression level of EGFP of E.coli BL21 (DE3) under the conditions of IPTG concentration of 1 mM, 1.5mM, 2 mM, 2.5mM and 3 mM at 37℃. The horizontal axis shows the different concentrations of IPTG, the vertical axis shows the relative normalized expression level of EGFP of each test group.

From Fig 3, we can conclude that the optimum IPTG concentration is 2.5mM, which is corresponding to the result in Fig 2(C). However, the expression level between 1mM to 2mM IPTG showed a slow downward trend. We speculated that the actual expression level from 1mM to 2mM IPTG were very closed due to both of them were not the most suitable for BBa_K1402010, but the degradation rate caused by different bacterial denisity were different, resulted in a slow downward trend.

Protocol

Fluorescence Characterization

1. Linearize pSB1c3 plasmid by PCR. (F: TACTAGTAGCGGCCGCTGCAG,R: CTCTAGAAGCGGCCGCGAATTC)
2. Obtain the sequence of BBa_K1402010 from 2019 DNA Distribution Kit by PCR. (F: GAATTCGCGGCCGCTTCTAGAG, R: CTGCAGCGGCCGCTACTAGTA)
3. Obtain the RBS+EGFP sequence and part sequence by PCR. Plasmid contained EGFP sequence was kindly donated by Associated Prof. Wentao Jin, sequence was identical to UniProtKB - A0A2V2QJP9 (F:AAAGAGGAGAAATACTAGATGAGCAAGGGC, R:TTACTTGTACAGCTCGTCCATG)
4. Use homologous recombination to construct the BBa_K1402010-EGFP pasmid
5. Transform the recombination plasmids into E.coli DH5α, then pick the positive clones and sequence.
6. After recombinational sequence results were comfirmed, transform the plasmids into E.coli BL21(DE3).
7. Coated the transformed BL21 onto the plate and added 1mM IPTG.
8. Incubated at 37℃ overnight and observed colony color under the blue light to see if the EGFP is expressed
9. Picked greener single colonies, add them into 1mL Lb, incubate at 37℃ in a shaker for 6-8h till the OD600 reach 0.6-0.8.
10. Add 50μl germ solution from last step into 5mL Lb, add IPTG in different concentration and induce for 5h at 25℃, 30℃ and 37℃.
11. Measure the fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) and OD600.

RT-qPCR

1. Pick a single colony from BBa_ K1402010 and inoculate in 5mL liquid LB medium + 5μL Chloramphenicol (25mg/mL in EtOH) and grow the cells overnight at 37 °C and 220 rpm.
2. Inoculate 50μL of the overnight culture into 4.95 mL LB with Chloramphenicol to make 7 parallel groups and grow the cells at 37 °C and 200 rpm until OD600 reaches 0.6.
3. Add IPTG to final concentrations of 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3mM IPTG respectively and grow the cells at temperature of 37℃ and 200 rpm for 5 hours.
4. Extracted RNA, make reverse transcription and carry out RT-qPCR with 16S rRNA as reference genes. RT-qPCR data was proceeded by Bio-Rad CFX Maestro.

RT-qPCR primer for EGFP:
F: AGATCCGCCACAACATCGAG, R: AACTCCAGCAGGACCATGTG

RT-qPCR primer for 16srRNA:
F: AACACATGCAAGTCGAACGG, R: TAAGGTCCCCCTCTTTGTGC